Order from us for quality, customized work in due time of your choice.
Introduction
DNA cloning and sequencing is one of the most essential techniques in molecular biology. This involves the insertion of a fragment of DNA into a vector, for example, a plasmid in order to create a new recombinant molecule (Stark, 1987). The green fluorescent protein (GFP) is a protein that fluoresces in blue light (Tsien, 1998). It has a typical beta-barrel structure with one ²-sheet and one ±-helix with a chromophore running through the center and has 238 sub-units of 26.9 kDa units (Yang et al., 1996). GFP generally refers to the protein first extracted from jellyfish Aequorea victoria. However, other derivatives of GFP exist. The GFP is mainly used as an expression reporter gene, but in advanced cases, it has been used in biosensor systems (Chalfie et al., 1994).
Two methods of determination of the sequence of a DNA molecule have been devised. One is the Maxam-Gilbert sequencing method, which employs the sequential chemical cleavage of DNA molecules, followed by the separation of the molecules on polyacrylamide gel. This method however is destructive as the DNA is denatured into smaller pieces and thus cannot be used in subsequent analyses. The other method is the Sanger method which uses dideoxy sequencing, and this method is now widely used in labs today. The Sanger method uses dideoxynucleotides to synthesize radio-labeled DNA sequence. The dideoxynucleotides only differ from deoxyribonucleotides in that they lack an OH group on the 3 end of the deoxyribose ring. For this reason, no additional nucleotides can be attached to the DNA chain hence effectively terminating the synthesis of DNA.
The following are the requirements for dideoxy sequencing to take place:
-
DNA (template) which must be single-stranded. Double-stranded DNA must be denatured before carrying out the reactions.
-
DNA polymerase is used to carry out DNA synthesis.
-
A Prime. This is a short piece of single-stranded DNA that binds to the template DNA (usually an oligonucleotide -20 nucleotides long).
-
Deoxyribonucleotides (dNTPs). A mixture of dATP, dCTP, dGTP and dTTP.
-
A radio-active labeled deoxyribonucleotide. Usually, one of the deoxyribonucleotides should be radioactively labeled, so that the synthesized DNA molecules will be radio-active labeled too.
Aim of this experiment
The aim of this experiment is primarily to clone a fragment of DNA which includes the Green Fluorescent Protein (GFP) gene into the vector pTTQ18 which is an expression vector with a multi-cloning site located downstream from the strong Ptac promoter, and an ampicillin resistance gene to provide a selectable marker for the plasmid.
Materials and Equipment
-
Plasmid vector pTTQ18
-
GFP gene PCR product
-
EcoRI enzyme
-
Pstl enzyme
-
1% Agarose (gel) preparation
-
Gel red dye
-
E. coli bacteria
-
DNA markers
Procedure
Step 1: Restriction digests and agarose gel electrophoresis
-
DNA from the plasmid vector pTTQ18 and a PCR amplification product that encodes a copy of the GFP gene was obtained.
-
Restriction digests of each of pTTQ18 and the GFP gene PCR product were set up in separate tubes with the enzymes EcoRI and PstI.
-
This preparation was then incubated at 370°C for 1 hour.
-
At the end of 1 hour, the samples were loaded from the restriction digest and ran on an agarose gel. The gel contained 1.0% agarose and a small amount of GelRed non-toxic fluorescent dye which was used as a substitute for ethidium bromide, which is a toxic dye. The basis of this step was to allow for visualization of the DNA under UV light after the run.
-
Then 4 ¼l 6× loading buffer was added to 20-¼l samples before loading the samples to the appropriate well. DNA markers which form a DNA ladder were loaded on the gel so that the size of the bands could be easily estimated.
-
The 1.0% gel was then run for 30 min at 100 V.
Step 2: Ligation
-
The restriction digested samples from the previous week were used to set up a ligation. An insert to vector ratio of approximately 3:1 was used for this exercise.
-
The tubes were then carefully labelled and placed in the rack that was provided. The ligation mixes were then incubated at 150°C overnight.
Step 3: Transformation
-
From the previous samples, 5 ¼l of the ligation mix was taken and added to 50 ¼l of competent E. coli JM101 cells.
-
This was then mixed and let to stand on ice for 30 minutes. The cells were later heat shocked at 420°C for 1 minute, and then incubated on ice for 5minutes.
-
To this was added 950 ¼l of LB, the contents mixed and then incubated at 370°C for 45 minutes.
-
Finally, 100 ¼l of the sample were plated onto L-agar ampicillin.
-
Overnight incubation at 370°C was then done.
Step 4: Observation
Observations of the colonies on the transformation plates were made and recorded, and the green and white colonies counted and recorded.
Step 5: Sequencing
One of the colonies was selected as an example colony, and then sequenced DNA isolated from this colony using primers GFP_F and GFP_R.
Observations
In this experiment, there is a PCR amplified segment of DNA containing the GFP gene. The plasmid vector pTTQ18 and the PCR product were digested with restriction enzymes and the desired DNA fragments gel-purified and ligated together with the enzyme DNA ligase to make a recombinant DNA molecule. The pTTQ18-GFP recombinant plasmid was then transformed into E. coli, allowing expression of the GFP gene and eventually making green fluorescent E. coli colonies. DNA sequencing was used to confirm the correct insertion of the GFP gene in pTTQ18.
Discussion and Conclusion
All of the DNA molecules generated from the above experiment were radio-labelled. Polyacrylamide gel electrophoresis was used to separate the DNA molecules, which were then detected by autoradiography. The samples from the four reaction mixtures were loaded into adjacent wells on the gel. The DNA fragments were then separated by electrophoresis according to their size (length). The shortest fragments of the proteins were located at the bottom of the gel.
The DNA sequence is read from the gel by starting at the bottom and writing, in order, the lanes in which the bands are found. In the experimental gel, the first two bands were found in the G lane, so the sequence can be said to begin with GG, then the next two bands are found in the C lane, thus this makes the next sequence to be GGCC. The complete sequence read from the experimental gel is:
5 GGCCTTATAGGTCCGTCGCGATTATTAAGTTGACGCCGTAGCTATGCC 3
Reading from the bottom upwards, the gel gave the sequence in the 5 32 direction.
References
Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. & Prasher, D. (1994). Green Fluorescent Protein as a Marker for Gene Expression, Science 263 (5148), 8025.
Stark, M. J. (1987). Multicopy Expression Vectors Carrying the Lac Repressor Gene for Regulated High-Level Expression of Genes in Escherichia Coli. Gene 51, 255-267.
Tsien, R. (1998). The Green Flourescent Protein, Annu Rev Biochem 67, 50944.
Yang, F., Moss, L. & Phillips, G. (1996). The Molecular Structure of Green Fluorescent Protein, Nat Biotechnol 14 (10), 124651.
Order from us for quality, customized work in due time of your choice.